Prs41h
WebbThis application discloses a kind of method that utilization terminator regulates and controls genes of brewing yeast expression intensity, belong to bioengineering field.The … Webb10 apr. 2024 · Then the sequences of eight native promoters were amplified by PCR with the genomic DNA of S288c as template and cloned into the MCSs of pRS41H-yEGFP …
Prs41h
Did you know?
WebbpRS41H hphNT1 ARS/CEN EcoRI: 1769; 3620 pRS41K kanMX4 ARS/CEN HindIII: 1249; 3929 pRS41N natNT2 ARS/CEN XmaI: 1605; 3409 pRS42H hphNT1 2μ EcoRI: 1769; 4448 … WebbpRS41H; pRS41H. Cat.No. VET1188. Selection. Ampicillin. Source. Saccharomyces cerevisiae, Escherichia coli. Species. Bacterial. Q&A Customer Reviews. Ask a Question. …
Webb12 maj 2010 · Global transcription engineering was developed as a tool to reprogram gene transcription for eliciting new phenotypes important for technological applications (Science 2006, 314(5805):1565-1568). A recent report indicated that the beneficial growth advantage of yeast cells expressing the SPT15-300 mutation is the result of enhanced … WebbIn this study 1240 bp KpnI-GPD promoter-HSP12-CYC terminator–SacI fragment we investigated the possible role of Hsp12p in freezing was subcloned on pRS41H …
Webb30 nov. 2010 · For overexpression of HAP4, a RPS2 (promotor)–HAP4 (overexpressed gene)–CYC1 (terminator) construct was cloned into the pRS41H plasmid. Liquid cultivations were carried out in minimal medium batch cultures as described by Blank and Sauer (2004) with 10 g/l glucose or galactose. WebbYeast plasmids pRS41N and pRS41H that confer clonNAT and hygB resistance, respectively, to N. crassa and C. parasitica. Unique restriction sites in the multiple …
WebbGeneral: Vector Or Plasmid Name: pRS41H map seq: Serial Number: 105: Genbank Accession: Manufacturer: Private: Size: 5389: Expression Host: Yeast: Basic Details ...
WebbpRS41H containing the hphNT1 gene was adopted as the template in a polymerase chain reaction (PCR) to amplify the hphNT1 open-reading frame flanked by regions homol-ogous to URA3 DNA sequences in pSH47. The plasmid Table 1 Primers used in this study Name Sequence(5′→3′) SPT15 F TCGAGTGCTAGCAAAATGGCCGATGAGGAA CGTTTAAAGG hyper x wireless headphone usbWebbTwo plasmids that were previously used with yeast, pRS41N and pRS41H, were found to confer clonNAT and hygromycin B resistance, respectively, in the filamentous fungi … hyper x wireless headphones xboxWebbAbstract. Multiple mechanisms have been proposed for gene silencing in Saccharomyces cerevisiae, ranging from steric occlusion of DNA binding proteins from their recognition … hyperx x cloud stingerWebb15 juni 2024 · Section snippets Strains and medium. The S. cerevisiae INVSc1 (MATα/MATα his3Δ1 leu2 trp1-289 ura3-52) strain was obtained from Invitrogen, Carlsbad, California and was used to carry out the manipulation studies.Engineered strains transformed with pRS41H (EUROSCARF, Germany) or rDNA site and were selected on … hyperx xmp 16 goWebbCN103898113A CN201410088336.8A CN201410088336A CN103898113A CN 103898113 A CN103898113 A CN 103898113A CN 201410088336 A CN201410088336 A CN 201410088336A CN 103898113 A CN103898113 A CN 103898113A Authority CN China Prior art keywords promotor transcription factor sequence binding site primer Prior art … hyperx wireless mouse softwareWebbTwo plasmids that were previously used with yeast, pRS41N and pRS41H, were found to confer clonNAT and hygromycin B resistance, respectively, in the filamentous fungi … hyperx wireless headphones with usbWebbIn the Materials & Methods: pRS41H was a gift from Michael Knop (European Plasmid Repository plasmid #339). In the References: Taxis C et al.. System of centromeric, … hyperx x alloy origins 60